rs78985074 chr12:52120228 C>T
- Sequence
gtggccctaagagtatagccgctc[C/T]cagggcctgggctacctggtgcag
- ASB in cell types
- WA09 (embryonic stem cells) epithelial cell of proximal tubule uterus hepatocytes
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.42 | 0.87 | 1.22 | n/a | No Hit | |||
| STAG1_HUMAN | -0.36 | 1.45 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2