rs789964 chr6:63065983 A>T
- Sequence
tatatttcttttacttagcaaatg[A/T]tttctagtaaacctgacagaaagt
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -1.48 | 2.04 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, insulinogenic index, ldl cholesterol change with statins, total cholesterol change with statins