rs79050455 chr10:31707440 C>G
- Sequence
actggatttccctggggaggggaa[C/G]aaagagtgagagcataggccgttc
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.83 | n/a | 2.75 | 3.67 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
