rs79061565 chr19:11587844 C>G
- Sequence
cacagcctgaactgcagcaccgaa[C/G]gcagacccagtttcccttttggag
- ASB in cell types
- neutrophils MCF7L-P(immortalized breast epithelial cell line) epidermal keratinocytes MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | 3.31 | -0.77 | 1.50 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -1.14 | 1.35 | 2.00 | |||
| epidermal keratinocytes | 1.74 | -0.53 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.46 | 1.28 | 2.23 | |||
| CD34+ hematopoietic stem cells | 2.01 | n/a | 2.00 |
Items per page:
1 – 5 of 5