rs790888 chr1:237814701 G>C
- Sequence
agtccaaggtagaaagatgattgt[G/C]gctagatagccagggagtctgact
- ASB in cell types
- LNCaP (prostate carcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.09 | -0.30 | 1.00 | |||
| neural cell | 1.39 | 0.26 | 1.00 |
Items per page:
1 – 2 of 2