rs79092274 chr12:48957286 C>T
- Sequence
ccgagcctcttctctaccgggacc[C/T]gccttcccttcccagcctctcacc
- ASB in cell types
- primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 3.58 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Thyroid, Whole_Blood