rs79095511 chr11:65019885 A>G
- Sequence
gggtggagcaggtcagatgagatc[A/G]gggccgtcaaatgctggtcaaggc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- NR2F6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2F6_HUMAN | 2.47 | 0.03 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood