rs79101008 chr15:52784173 C>A
- Sequence
gggaagcagggagcgcggagggct[C/A]gaggcttgcagataaggagaggcg
- ASB in cell types
- LNCaP (prostate carcinoma) LNCaP C4-2B (prostate carcinoma) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- CTCF_HUMAN EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.55 | 1.97 | 1.32 | n/a | No Hit | |||
| EZH2_HUMAN | -0.32 | 1.38 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2