rs79105848 chr10:66626327 G>A
- Sequence
aacacgaagcaaaccttgatgttt[G/A]ctgagattttcattgtcacacatt
- ASB in cell types
- 22RV1 (prostate carcinoma) MDA-MB-134 (invasive lobular breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 3.12 | n/a | 2.00 | |||
| MDA-MB-134 (invasive lobular breast carcinoma) | 2.94 | -5.27 | 2.00 |
Items per page:
1 – 2 of 2