rs79119940 chr7:38354439 C>A
- Sequence
agctcctgcctctcttgctcaggt[C/A]cgttctccggcgccctcttgtggc
- ASB in cell types
- neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | 2.17 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Lung, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Testis, Whole_Blood