rs791459 chr19:1454043 T>C
- Sequence
gggccagcagagggaggcagggtc[T/C]gggcaccctgtgcagctgggaggg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.13 | 1.14 | 1.97 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Pituitary, Spleen, Testis