rs79148501 chr7:140343271 G>A
- Sequence
ttaggacgcatcagctggtcctga[G/A]gggagacggaagtccttgggctct
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) CD14+ monocytes
- ASB for transcription factors
- STAG1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.79 | 0.00 | 1.00 | n/a | n/a | |||
| STAT1_HUMAN | 2.58 | n/a | 3.00 | 0.03 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
