rs79186925 chr1:169546698 T>C
- Sequence
ctgcgcacctacaactatctgatc[T/C]gtgacaaaagcaagcaatagggaa
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) A549 (lung carcinoma) FT282 (normal human fallopian tube tissue)
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 1.29 | -0.23 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1