rs79187171 chr7:67302927 G>A
- Sequence
tccttcccccccaccccgcgccaa[G/A]tgcgcacgcgcggcggccggctgc
- ASB in cell types
- primary B-CLL cells 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.82 | -4.33 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Lung, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid