rs79194220 chr7:99616920 C>G
- Sequence
gagaggacacggaagcgagtcttt[C/G]cttacgcacctgtctaacagcgtc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CREB1_HUMAN TYY1_HUMAN TGIF2_HUMAN HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -0.03 | 1.31 | 1.36 | n/a | No Hit | |||
| TYY1_HUMAN | 2.87 | 0.71 | 1.00 | n/a | No Hit | |||
| TGIF2_HUMAN | 2.65 | n/a | 1.00 | n/a | No Hit | |||
| HTF4_HUMAN | 2.85 | n/a | 1.25 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood