rs79199238 chr6:32415539 T>C
- Sequence
ccattcatcctgggttcttttact[T/C]ggtcctcttggggcctctgagagg
- ASB in cell types
- THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.84 | 0.05 | 2.00 |
Items per page:
1 – 1 of 1