rs79201203 chr2:119476334 C>A
- Sequence
acccacccccaggctgggtatgaa[C/A]aacgtggcccccaccaccctggag
- ASB in cell types
- erythroid cells CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.25 | n/a | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.21 | -1.25 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Spleen, Testis, Thyroid