rs79214845 chr22:46366958 G>A
- Sequence
ccccgcccctcgagatgccgccca[G/A]cccccagtcccgcggtgtccccgg
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.27 | 3.64 | 1.33 | 0.22 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Esophagus_Muscularis, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid