rs79223272 chr19:33721252 A>C
- Sequence
agcatgtgtttgccttgacaccag[A/C]agatggagccctgagccaactcac
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) LUHMES (lund human mesencephalic cells) neural progenitors Kelly (neuroblastoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.05 | 3.19 | 1.87 | 1.68 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
