rs79233968 chr5:43627189 C>T
- Sequence
cacttgtggttgcaactttacctc[C/T]agggggcaatctgggctaccagat
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) FT282 (normal human fallopian tube tissue) adrenal gland transverse colon
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.58 | 1.96 | 1.21 | -0.27 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
