rs79239491 chr12:12267359 G>C
- Sequence
tttctgcggctcggccgggcagcc[G/C]tctgccccgctctttgtgcggccg
- ASB in cell types
- HepG2 (hepatoblastoma) ME-1 (acute myeloid leukemia )
- ASB for transcription factors
- HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HTF4_HUMAN | 2.71 | -2.78 | 1.00 | -1.34 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
