rs79263639 chr10:101214849 C>A
- Sequence
ccggatgggtggggaaaggggtgg[C/A]ttaagggcgggcactgctgctgag
- ASB in cell types
- erythroid progenitors KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 3.54 | n/a | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | -2.84 | 1.73 | 2.00 |
Items per page:
1 – 2 of 2