rs79270944 chr20:31823092 T>C
- Sequence
ggagggtgggcaggtcccaccacc[T/C]accccattattcagacatagcaac
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 0.03 | 1.48 | 2.89 | |||
| neural progenitors | 1.49 | -0.54 | 1.00 |
Items per page:
1 – 2 of 2