rs792975 chr5:172844004 A>G
- Sequence
tggcggcatagtcctgtgcacctc[A/G]ccgagccgtgatagatggcagtag
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.32 | -0.94 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, paclitaxel-induced neutropenia/leukopenia in cancer patients, total cholesterol change with statins, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg