rs79315926 chr18:76349199 G>A
- Sequence
ggtgcttaatttatgctggctgaa[G/A]acaacgaggtgaatgaatttgcat
- ASB in cell types
- foreskin keratinocyte epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.39 | n/a | 2.67 | |||
| epidermal keratinocytes | 2.00 | -1.08 | 2.00 |
Items per page:
1 – 2 of 2