rs7933 chr2:43225044 A>G
- Sequence
ccgagaagctgaggctgtggtgca[A/G]cttgggccgcggctcccgcgggaa
- ASB in cell types
- SMMC-7721 (hepatocellular carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SMMC-7721 (hepatocellular carcinoma) | 1.60 | n/a | 2.00 | |||
| K562 (myelogenous leukemia) | 0.72 | 0.26 | 1.99 |
Items per page:
1 – 2 of 2