rs79343474 chr10:75400219 G>A
- Sequence
gctcagcttcagggggcccgattt[G/A]gtgtccttgtcgcccgcagcaccg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.68 | 1.25 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.24 | -0.44 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pituitary, Prostate, Stomach, Thyroid