rs793463 chr3:99901408 T>C
- Sequence
tgacaagcgatgactcattttagc[T/C]catgtcaaaacaatgcacttttgt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) GM12878 (female B-cells lymphoblastoid cell line) Mel270 (Uveal melanoma) MDM(monocyte derived macrophages)
- ASB for transcription factors
- TF65_HUMAN IKZF1_HUMAN JUND_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.05 | n/a | 2.33 | n/a | No Hit | |||
| IKZF1_HUMAN | -1.29 | 1.63 | 1.25 | n/a | n/a | |||
| JUND_HUMAN | 1.21 | 0.03 | 1.17 | n/a | No Hit | |||
| SMCA4_HUMAN | 1.87 | 0.92 | 1.50 | n/a | n/a | |||
| FOSL1_HUMAN | 2.13 | 0.11 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid