rs793499 chr3:99846732 T>C
- Sequence
tttactatcatgaaattgattttg[T/C]aggggaaaggaggataattgtgaa
- ASB in cell types
- U937 (adult acute monocytic leukemia)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | 0.10 | 2.57 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis