rs79350161 chr16:69401955 A>T
- Sequence
tttttttagaggaagggagaaagg[A/T]actggcgttgtggggagtgattaa
- ASB in cell types
- macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.67 | -0.81 | 2.50 | -3.45 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
