rs79356410 chr10:102347434 C>T
- Sequence
ctgcaggtcatctttcttcacagc[C/T]tccagtggctgccgctgctgtgcc
- ASB in cell types
- kidney
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| kidney | 2.54 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Liver, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid