rs79372391 chr1:7810655 A>C
- Sequence
tcactctctgcatagacgtcatgt[A/C]tgtgattcgtgagcataaagtcat
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.04 | 1.25 | 1.00 | |||
| monocytes from periferal blood | 2.21 | -1.20 | 3.00 |
Items per page:
1 – 2 of 2