rs79378930 chr16:1379382 C>A
- Sequence
caccgaccccgcctagctagggga[C/A]gcaggcggcccgagcccgcgctgg
- ASB in cell types
- keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 2.25 | -1.76 | 1.50 | 1.68 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
