rs79384355 chr16:3500998 T>G
- Sequence
gtccattggttgccatagagatcg[T/G]cgagcgctgggcctgtgatcgctg
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.44 | -0.14 | 5.00 | n/a | No Hit | |||
| BRD4_HUMAN | -0.72 | 1.80 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Colon_Sigmoid, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg