rs79388148 chr9:87813063 C>T
- Sequence
tggcttagtagcatcatctaatgg[C/T]gagcaggggcactgcagcccctgg
- ASB in cell types
- esophagus squamous epithelium primary human epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| esophagus squamous epithelium | 2.10 | -0.82 | 1.00 | |||
| primary human epidermal keratinocytes | 2.84 | n/a | 2.00 |
Items per page:
1 – 2 of 2