rs79390616 chr4:112524005 C>A
- Sequence
ggacgcgctctggtcctggagggc[C/A]gggcccgcccgagggcagccgatt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) RCC 7860 (Renal cell carcinoma) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.93 | 0.53 | 1.15 | |||
| RCC 7860 (Renal cell carcinoma) | 3.48 | n/a | 2.00 | |||
| RWPE1 (prostate epithelial cells) | 1.37 | -1.37 | 1.00 |
Items per page:
1 – 3 of 3