rs79396500 chr10:21278852 G>A
- Sequence
tagaatcaggcctcctcactcccc[G/A]caaggcctgtccaccacactggct
- ASB in cell types
- A549 (lung carcinoma) HCPEpiC (choroid plexus epithelial cells) erythroid progenitors GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.32 | 0.90 | 2.00 | |||
| HCPEpiC (choroid plexus epithelial cells) | 2.75 | n/a | 1.50 | |||
| erythroid progenitors | 2.60 | -1.82 | 2.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.22 | 0.69 | 1.00 |
Items per page:
1 – 4 of 4