rs79398632 chr3:148957803 T>C
- Sequence
aggacacaactcagtcctcaacaa[T/C]aggcaaggcaggactcaaaggaac
- ASB in cell types
- HepG2 (hepatoblastoma) heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.32 | 1.33 | 1.10 | |||
| heart left ventricle | -1.56 | 2.12 | 1.00 |
Items per page:
1 – 2 of 2