rs79401056 chr1:43994960 G>C
- Sequence
gggccagacgtctatgctgggtca[G/C]cccccaagcagcagagggcagtgt
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) pancreas Peyer's patch H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 0.16 | 1.63 | 1.00 | |||
| pancreas | n/a | 2.84 | 1.00 | |||
| Peyer's patch | -2.34 | 2.72 | 1.00 | |||
| H929 (plasma cell myeloma) | -2.77 | 2.93 | 1.00 |
Items per page:
1 – 4 of 4