rs79412573 chr15:90185262 T>C
- Sequence
ctggggcccgccgcccggggagcc[T/C]gttgccatggcagcgcaggaggct
- ASB in cell types
- HEK293 (embryonic kidney) primary B-CLL cells 22RV1 (prostate carcinoma)
- ASB for transcription factors
- BRD4_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.79 | 0.39 | 1.40 | n/a | n/a | |||
| ANDR_HUMAN | 1.93 | -1.31 | 2.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood