rs79436692 chr15:41283961 G>A
- Sequence
ataaacactcagccccagcggcgg[G/A]ggcggggcttgtgggaacggccca
- ASB in cell types
- CD14+ monocytes monocytes from periferal blood
- ASB for transcription factors
- STAT1_HUMAN SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.21 | -0.13 | 1.83 | n/a | No Hit | |||
| SRBP2_HUMAN | 2.91 | 0.18 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Thyroid