rs79439126 chr14:69465026 T>C
- Sequence
ttgcaaacataaactatccagggg[T/C]cttccgtgagtcactgtgttagca
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) SK-MEL-147 (melanoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- JUND_HUMAN FOSL2_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | -0.77 | 0.77 | 1.00 | n/a | No Hit | |||
| FOSL2_HUMAN | -2.74 | 3.05 | 1.00 | n/a | No Hit | |||
| TF65_HUMAN | 1.53 | -0.76 | 2.50 | 0.59 | Weak Discordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood