rs79451789 chr2:205904111 G>A
- Sequence
tttggggcactcagttacctcctt[G/A]taaaatgttgtcctccatattttc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.77 | -2.49 | 1.33 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.49 | -0.84 | 1.00 |
Items per page:
1 – 2 of 2