rs79457495 chr6:168071732 C>T
- Sequence
gccctcccacctgggaactccctc[C/T]gcagggtaaagacaaggcaaacac
- ASB in cell types
- GM02630 (Fanconi anemi) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -2.28 | 2.31 | 1.33 | |||
| 22RV1 (prostate carcinoma) | 1.63 | -1.25 | 1.00 |
Items per page:
1 – 2 of 2