rs79480970 chr3:187187426 G>A
- Sequence
tctaggtcaagaattgtgtcccag[G/A]gaagtaaatatctgctctgggaca
- ASB in cell types
- CFPAC-1(pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CFPAC-1(pancreatic ductal adenocarcinoma) | -0.50 | 1.38 | 1.00 |
Items per page:
1 – 1 of 1