rs79518674 chr11:134868809 C>T
- Sequence
gaagatttagaaatgatttttgct[C/T]agaaaggaaaagccgggagcataa
- ASB in cell types
- HMEC (human mammary epithelial cells) tibial nerve THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- CTCF_HUMAN STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.81 | 0.54 | 1.27 | n/a | No Hit | |||
| STAG2_HUMAN | 2.24 | -2.06 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2