rs79520630 chr7:4798550 C>G
- Sequence
acccacgctgtcaccccgaggcag[C/G]aagtgccctgccctggtcctgcgc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -0.64 | 1.53 | 1.50 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.05 | 1.08 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis