rs79534852 chr6:342537 A>G
- Sequence
gcaagttgcagaccagcagtctgg[A/G]gccacttctgggccagatgagttg
- ASB in cell types
- iPS-derived dermal fibroblasts GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived dermal fibroblasts | 2.54 | -2.26 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.35 | -1.58 | 2.00 |
Items per page:
1 – 2 of 2