rs795604 chr4:139657504 C>T
- Sequence
agcaaaggtgagaaccaggcacac[C/T]ctaagggcaagcaggagggaagaa
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -2.77 | 2.93 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.02 | 0.80 | 2.02 |
Items per page:
1 – 2 of 2