rs79561263 chr9:95908011 C>T
- Sequence
ctgagagcaatagagtgcccccta[C/T]agtgttgtcagcagattaccgata
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) H929 (plasma cell myeloma) Peyer's patch
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.73 | -0.35 | 1.14 | -2.21 | Concordant | |||
| STAG1_HUMAN | 1.70 | -2.72 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid